INFECTION OF BIPOLARIS CACTIVORA (PETRAK) ALCORN OF DRAGON FRUITS (HYLOCEREUS UNDATUS (HAW.) BRITTON AND ROSE) AND POSTHARVEST TREATMENTS TO CONTROL THE DISEASE

  • Thailand
  • Management of Pests and Diseases
  • 2016.09.05
  • 110
PDF 2

Author

Somsiri Sangchote and Araya Chaidee

Abstract

Disease incidence of fruit rot, caused by Bipolaris cactivora, on dragon fruits obtained from Nakorn Ratchasima and Samut Sakorn provinces was at 4 and 14.7%, respectively. This pathogen was identified by its morphological characteristics and confirmed by molecular sequencing. It infected the fruit directly and through wounds. Conidia germinated and produced appressoria within 3 hours after inoculation under the moist condition at 25°C. Infection mycelia penetrated through cell junctions and stomatal openings. After three days, hypha had extended both intracellular and intercellular. Later, conidiophores and conidia were formed on the infected area. Dipping conidia of B. cactivora in hot water at 55°C for five minutes reduced conidial germination by 97.4%. Postharvest treatments by dipping in hot water at 51, 53 and 55°C for one minute showed fruit rot at 53.5, 49.1 and 44.8%, respectively. In vitro, PDA amended with difenoconazole  at 37.5 ppm showed completed inhibition of mycelial growth of B. cactivora. Dipping the fruit in this chemical at the same concentration for one minute at ambient temperature showed complete control of fruit rot. The chemical residue in the fruits treated with difenoconazole at 37.5 ppm for 1 min was 0.07 mg/kg after stored at 25°C for five days.

Keywords

INTRODUCTION
Pitaya fruit (Hylocereus undatus (Hew.) Britton & Rose ) is originate from Maxico and Central and Southern part of USA (Mizrahi et al.,1997). It’s grown in many areas in Thailand since it has been introduced from Vietnam  in 1991. This fruit is popular in Taiwan, Singapore, China, Hong Kong. (Valdivia,2000). He et al.,(2012) reported that pitaya fruits which were exported from Viet Nam to Kunming and Yunnan in China  had fruit rot caused by Bipolaris cactivora.In Israel, this disease also reported on pitaya fruit. In Thailand, fruit rot caused by B. cactivora was not so severe like anthracnose or other fruit rot (Dothiorella dominicana). However, it was found in many producing areas such as Nakorn Ratchasima, Luae provinces. In this studies, fruit rot of pitaya fruit caused by B. cactivora was investigated and different control measures were evaluated.
MATERIALS AND METHODS
Postharvest fruit rot
Pitaya fruits were randomly picked from the field in Pak Chong, Nakorn Ratchasima Province and Ban Phaeo, Samut Sakorn Province at 50 fruits/location (10 fruits/replicate). Disease incidence was checked after 5 days storage at 25°C. Diseased fruits were isolated for the causal organisms by tissue transplanting method. In additional, some disease fruits were collected from  Phu Ruea, Loei Province were also isolated. After suspected Bipolaris cactivora colonies developed, single spore isolation was performed. Obtained isolates were inoculated to the healthy fruits to confirm for their symptoms. Inoculated fruits which fungus started to developed on the symptom, affected tissues were cut and free hand section to study their morphological characteristics for identification.
The isolates of B. cactivora were also confirmed by molecular technique.
DNA  extraction 
Fungal mycelium was cultured in malt broth for 4 days. The mycelium was harvested with forceps, followed by suspending in extraction buffer (Alexandra et al., 2007). After that the chloroform:isoamyl alcohol (24:1)  was added and incubated on ice for 5 min and centrifuged at 14000g for 10 min. Clear supernatant was transferred to a new micro-tube and 400 µl of isopropyl alcohol was added for nucleic acid precipitation. That tube was centrifuged at 14000 g for 5 min, discarded isopropanol and washed pellet with 70% of ethyl alcohol 2 times. After washing, the DNA was suspended with 25 µl RNase water.     
PCR amplification 
The internal transcribed spacer (ITS) region including ITS1, 5.8sRNA gene and ITS2 was amplified by using ITS1 primer 5'GCCGTAGGTGAACCTGCGG3') and ITS4 primer (5'TCCTCCGCTTATTGATATGC3') (White, 1990). PCR was performed in 25 µl reaction mixture containing 0.25mM dNTPs, 0.5 U Taq polymerase (Thermostatic dream taq, Thermostatic), 0.1µM primer and 50 ng DNA template. The PCR cycle consisted of one cycle of 5 min at 95°C, 30 cycle of 45 sec at 95°C, 45 sec at 60°C, 45 sec at 72°C and final cycle of 72°C for 5 min. PCR products were sent for sequencing analysis at Macrogen, Korea. Obtained sequences will be analyzed and compared with data base in GenBank for their similarity.
Pathogenicity and Infection studies 
Light microscopy
Conidial suspension of B. cactivora, obtained from 7 days old culture, at concentration of 1x105 spore/cc were sprayed on Pitaya fruits. Inoculated fruits were incubated in moist condition at 25°C for 3, 6, 9, 12, 15, 18, 21 and 24 hr. Each period, fruit tissues were peeled and mounted in lactophenol cotton blue to examine for conidial germination and appressorial formation.
Scanning electron microscopy
Conidial suspension of B. cactivora, obtained from 7 days old culture, at concentration of 1x1012 spore/cc were sprayed on Pitaya fruits. Inoculated fruits were incubated in moist condition at 25°C for 3,6,9,12, 15,18 21 and 24 hr. Each period, fruit tissues at the size of 0.5x0.5 cm2 were collected and fixed in glutaraldehyde 2.5% . These tissues were dehydrated with alcohol series: 10, 20, 50, 75, 90 and 95% for 10 min in each step and then, absolute alcohol for 3 times (10 min each). Alcohol was removed in critical point drier using liquid carbon dioxide. Tissues were fixed on the stub and coated with gold, then, investigated with scanning electron microscope.
Histopathology
Mycelial plugs of B. cactivora, obtained from 7 days old culture were used to inoculate  Pitaya fruits. Inoculated fruits were incubated in moist condition at 25°C for 24 and 48 hr. Tissues in the inoculated areas at the size of 0.5x0.5 cm2 were collected and fixed in FAA for 4 hr and then, dehydrated in alcohol series:50, 70, 80, 95, 100%  at 24hr in each step and paraffin oil for 3 times 24 hr.in each step. These tissues were mounted in paraffin and made thin sectioning with rotary microtome and stained with safranin O and fast green procedure. They were examined under compound microscope. 
Hot water treatment 
Effect of hot water on conidial germination 
Agar plug with the conidia obtained from 7 days old culture of  B. cactivora was mixed in 4 cc. of hot water at 51,53, 55°C in the test tube with vortex mixer and  dipped in the water bath at the same temperature for 1,3,5 min and then, cold water. Conidial suspension at 500 µL was transferred to potato dextrose agar (PDA) plate, smeared and incubated at 25°C for 3 hr. Germinated conidia were counted under microscope.
Effect of hot water on fruit rot 
Pitaya fruits were inoculated with mycelium plug (0.5 cm in diameter) obtained from 5 days old colony of B. cactivora on both side of the fruits and incubated in the moist condition for 18 hr at 25°C. These fruits were dipped in hot water at 51, 53, 55°C for 1 min, followed by cold water using 15 fruits/treatment (5 fruits/replication). Untreated fruits were dipped in water at ambient for 1 min as control. 
Fungicide treatment 
Efficacy of fungicide on growth of B. cactivora in culture 
Three fungicides including difenoconazole at 37.5, 75, 150 and 225 ppm, imazalil, and prochloraz at 250, 500, 750 ppm were tested their efficacy against B. cactivora using poisonous food technique. These fungicides were amended to PDA and mycelial plug was transferred to the agar. Radial growth of the colony were measured. 
Fungicide treatment on fruits 
Pitaya fruits were inoculation with mycelium plug (0.5 cm in diameter), obtained from 5 days old colony of B. cactivora on both side of the fruits and incubated in the moist condition for 18 hr at 25°C.Dipping these inoculated fruits in imazalil and prochloraz at 0, 250, 500, and 750 ppm for 3 min and difenoconazole at 0, 75, 150, and 225 ppm for 3 min using 15 fruits/treatment (5 fruits/replication). Treated fruits were kept at 25°C for 5 days and then, disease incidence was evaluated. 
Combined hot water and chemical treatment 
Pitaya fruits were inoculated with mycelium plug (0.5 cm in diameter), obtained from 5 days old colony of B. cactivora on both side of the fruits and incubated in the moist condition for18 hr at 25°C. These inoculated fruits were treated with fungicide at the selected temperature for 1 min. Disease incidence were checked after 5 days storage at 25°C. 
RESULT
Postharvest fruit rot
Fruit rot of pitaya fruits Pak Chong, Nakorn Ratchasima Province and Ban Phaeo, Samut Sakorn Province was 4.0 and 14.7% respectively (Table 1.) In both areas, pitaya fruits were severely attacked by others pathogens including Colletotrichum capsici and Dothiorella dominicana. Ban Phaeo, pitaya was grown on the rising bed with canal beside so moisture was rather high compared to Pak Chong.
Table 1. Fruit rot incidence (%) on pitaya fruits caused by Bipolaris cactivora after storage at 25°C for 5 days
Locations Disease incidence (%)
Pak Chong, Nakorn Ratchasima Province 4.0
Ban Phaeo, Samut Sakorn Province 14.7
Isolates of B. cactivora obtained from diseased fruits from Pak Chong, Nakorn Ratchasima Province, Ban Phaeo, Samut Sakorn Province, and Phu Ruea, Loei Province, they were similar in their morphological characteristics.  It produced conidiophore in group, light brown color with light to dark brown conidia, straight conidia taper to the end with 2-4 septate, measure 21.6-44.5x4.3-11.8 µ for Pak Chong isolate, Ban Phaeo  was 20.8-45.4x5.1-11.9 µ, and Phu Ruea was 51.8-98.7x11.6-22.6 µ (Figure 2)  which was similar to Alcorn (1983). However, conidia measure 20-54x6-11 µ.

Fig. 2.   Pitaya fruit rot (1) and its causal pathogen, Bipolaris cactivora  on the fruit surface (2), conidia (3) colony on potato  dextrose agar (4)       
The isolate from Phu Ruea was selected to confirm by molecular technique and it revealed that this isolate was similar to B. cactivora  accession no. KF 039902 from pitaya fruit rot in Viet Nam at 99% and B. cactivora  accession no. GU 390882 pitaya fruit rot in China at 99% 
Pathogenicity and Infection studies 
Conidia of B. cactivora germinated 76.3% and produced appressoria at 7.3% within 3 hr after inoculation. It germinated both end of conidia.  The highest appressorial formation was 21 hr after inoculation at 97.3%. (Fig. 3)

Fig. 3.   Germinated conidia and appressorium formation of B. cactivora  on dragon fruits after inoculated and incubated for 3 6 9 12 15 18 21 and 24 hr respectively     
It formed appressoria and infected directly between cell junctions or through stomata. It infected through the pericarp down to the fresh without latent period. Mycelia near to the fruit surface are formed in group and later, produced a group conidiophore with conidia protruded from the pericarp. (Fig. 4, 5 ).

Fig. 4. Germinated conidia of Bipolaris cactivora penetrated through stomata (1) and produced appressoria on the cell junctions (2).

Fig. 5. Mycelia of Bipolaris cactivora penetrated from the fruit surface into the fresh (1-3) and starting to formed in group (4,5) and produced conidiophore  and conidia on the fruit surface.(6,7) 
Hot water treatment
Effect of hot water on conidial germination
Conidia of B. cactivora after treating with hot water   at 51,53, 55°C for 1,3,5 min showed that   at 55°C for 5 min, conidial germination  was inhibited at 97.4% (Fig. 6).

Fig. 6. Conidial germination inhibition (%) of B. cactivora after treating with hot water at 51, 53 and 55°C, 1, 3 and 5 min
Effect of hot water on fruit rot 
Hot water treatment at 55°C could reduce fruit rot by 55.2 % but fruit showed some heat injury. At 53°C, it’s a proper temperature for pitaya fruit, disease was reduced by 50% (Table 3.)
Table 3. Disease reduction (%) of pitaya fruit rot caused by Bipolaris cactivora after inoculation and incubated  at 25°C in moist condition for 24 hr and then, dipped into hot water at 51, 53, and 55°C for 1 min.
Treatment Disease reduction (%)
Water at ambient
Hot water at 51°C		 0.0a
44.8b
49.1b
53.5b
Hot water at 53°C
Hot water at 55°C
Means in the column followed by the same letter are not significantly different at 5% level by DMRT
Fungicide treatment
Efficacy of fungicide on growth of B. cactivora in culture
B. cactivora showed no growth on the PDA amended with the 3 fungicides : difenoconazole at 37.5, 75, 150 and 225 ppm , imazalil, and prochloraz at 250, 500 and 750 ppm so difenoconazole at 37.5 ppm should be the best fungicide for further test.
Combined hot water and chemical treatment
It indicated that this fruit rot  could be completely controlled by dipping in  hot difenoconazole at 37.5 ppm for 1 min (Table 4.) and the residue of difinoconazole was 0.07 mg/kg.
Table 4. Disease incidence (%) of pitaya fruit rot caused by Bipolaris cactivora after inoculation and incubated  at 25°C in moist condition for 24 hr and then,dipped in hot water, difenoconazole,  hot difenoconazole  for 1 min and stored at 25°C for 5 days.
Treatment Disease incidence (%)
Water at ambient 95.0a
Hot water at 53°C 40.0b
Difenoconazole 37.5 ppm 5.0c
Hot difenoconazole 37.5 ppm 53°C 0.0c
Means in the column followed by the same letter are not significantly different at 5% level by DMRT
DISCUSSION
B. cactivora was an important pathogens of pitaya fruits as Athipunyakoom  et al.,(2007) had been reported. It started to germinate and produce  appressoria within 3 hr similar to Colletotrichum capsici, causal pathogen of anthracnose (Kesee and Sangchote,2013).  It infected the fruit from the pericarp and further down to the fresh which was different from Colletotrichum capsici , mostly mycelium still in the epidermal cells, so control measure had to apply immediately after harvest. Pitaya was rather sensitive to heat injury which was contrast to the conidia B. cactovora, hot water temperature needed to increase up to 53°C-55°C which was very close to heat injury temperature of dragon fruit. Sornvilai and Sangchote (2013) had been used hot water at 53C° for 1 min, it reduced fruit rot caused by Dothiorella dominicana by 40% .  At these temperatures, pitaya fruit started to show some heat injury symptom. However, in this study,  difenoconazole at 37.5 ppm  might be the other alternative if the destination market allowed to use it.
REFERENCES
Athipunyakoom, P., S. Likitarkarach, P. Takoolsukarat, D. Poonyapitak, B. Puawongpat, N. Tangjitsomkit, N. Kositakool, and A. Poopiboon. 2007.Studies on proper disease management for dragon fruit production. Division of Plant Pathology, Ministry of Agriculture and Cooperative, Bangkok. Annual Report 2007.
He, P.F., H. Ho, X.X. Wu, M.S. Hou, and Y.Q. He. 2012. Bipolaris cactivora causing fruit rot of dragon fruit imported from Vietnam. Plant Path. Qua. 2:31-35.
Kesee, C. and S. Sangchote. 2013. Infection and control of anthracnose of dragon fruits (Hylocereus undatus (Haw.) Brit.&Rose ) caused by Colletotrichum capsici (Syd.&P.Syd.) E.J. Blutler&Bisby.  Kasetsart J.43:25-28.
Mizrahi,Y.,Nerd, A.,and Nobel, P.S.1997. Cacti as Crops.Horticultural Reviews 18:291-320.
Sornvilai, S.and Sangchote, S.2013. Infection of dragon fruit (Hylocereus undatus (Haw.) Brit.&Rose ) caused by Dothiorella dominicana Pet.etCif. and its control. Kasetsart J.44:18-21.
Valdivia, E. 2000. A fruit for the diligent. The Fruits 32:12-13.

Comments

Please log in to comment

You may also like